shRNA Lentivirus (self-inactivating), pU6-(CCDC67-shRNA-Seq3)(CAT#: LV-SI0196WQ)

This product is a CCDC67-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The CCDC67 gene is key structural component of the deuterosome, a structure that promotes de novo centriole amplification in multiciliated cells. The expression of CCDC67-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert CCDC67-shRNA-Seq3
Related Target/Protein CCDC67
Region CDS
TargetSeq GCAATGACTCAGAATTATGAA
NCBI RefSeq NM_181645
Alternative Names DEUP1
Titer >1*10^10 GC/mL
Related Diseases Papillary thyroid carcinoma, gastric cancer
Target Gene
Gene ID 159989
Uniprot ID Q05D60

Related Products