shRNA Lentivirus (self-inactivating), pU6-(Cma2-shRNA-Seq1)(CAT#: LV-SI2220WQ)
This product is a Cma2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Zcchc5 gene has serine-type endopeptidase activity. The expression of Cma2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Cma2-shRNA-Seq1 |
| Related Target/Protein | Cma2 |
| Region | 3UTR |
| TargetSeq | CATCAGAGTCTTCAAGCCAGA |
| NCBI RefSeq | NM_001024714 |
| Alternative Names | Mcp10 |
| Titer | >1*10^10 GC/mL |
| Target Gene | |
|---|---|
| Gene ID | 545055 |
| Uniprot ID | A0A2I3BR33 |
