shRNA Lentivirus (self-inactivating), pU6-(Cyb5d2-shRNA-Seq1)(CAT#: LV-SI2036WQ)
This product is a Cyb5d2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Cyb5d2 gene encodes a heme-binding protein which promotes neuronal but not astrocyte differentiation. The expression of Cyb5d2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Cyb5d2-shRNA-Seq1 |
Related Target/Protein | Cyb5d2 |
Region | CDS |
TargetSeq | GCCGGTCTTGTGGATGATATA |
NCBI RefSeq | XM_109819 |
Alternative Names | CYB5D2 |
Titer | >1*10^10 GC/mL |