shRNA Lentivirus (self-inactivating), pU6-(Fam110b-shRNA-Seq1)(CAT#: LV-SI2213WQ)

This product is a Fam110b-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Fam110b gene may be involved in tumor progression. The expression of Fam110b-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Fam110b-shRNA-Seq1
Related Target/Protein Fam110b
Region CDS
TargetSeq CAGACTTGAGTGACAGGTATT
NCBI RefSeq NM_173426
Alternative Names C8orf72
Titer >1*10^10 GC/mL
Related Diseases Cancer
Target Gene
Gene ID 90362
Uniprot ID Q8TC76

Related Products