shRNA Lentivirus (self-inactivating), pU6-(FANCI-shRNA-Seq1)(CAT#: LV-SI0338WQ)

This product is a FANCI-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The FANCI gene encodes the protein for complementation group I. Alternative splicing results in two transcript variants encoding different isoforms. The expression of FANCI-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert FANCI-shRNA-Seq1
Related Target/Protein FANCI
Region CDS
TargetSeq CCCTGTGTTATTCTTTCATTT
NCBI RefSeq NM_018193
Alternative Names KIAA1794
Titer >1*10^10 GC/mL
Related Diseases DNA Damage
Target Gene
Gene ID 55215
Uniprot ID Q9NVI1

Related Products