shRNA Lentivirus (self-inactivating), pU6-(HSPA13-shRNA-Seq1)(CAT#: LV-SI0361WQ)

This product is a HSPA13-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by HSPA13 gene is a member of the heat shock protein 70 family and is found associated with microsomes. Members of this protein family play a role in the processing of cytosolic and secretory proteins, as well as in the removal of denatured or incorrectly-folded proteins. The expression of HSPA13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert HSPA13-shRNA-Seq1
Related Target/Protein HSPA13
Region CDS
TargetSeq CCTAAAGTGATTGGTATTGAT
NCBI RefSeq NM_006948
Alternative Names STCH
Titer >1*10^10 GC/mL
Related Diseases Oral Cancer
Target Gene
Gene ID 6782
Uniprot ID P48723

Related Products