shRNA Lentivirus (self-inactivating), pU6-(Ints10-shRNA-Seq1)(CAT#: LV-SI2344WQ)
This product is a Ints10-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Ints10 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit and mediates 3-prime end processing of small nuclear RNAs U1 and U2. The expression of Ints10-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Ints10-shRNA-Seq1 |
Related Target/Protein | Ints10 |
Region | CDS |
TargetSeq | GCCGACTTCAACATCCAGTAT |
NCBI RefSeq | NM_027590 |
Alternative Names | INT10; C8orf35 |
Titer | >1*10^10 GC/mL |