shRNA Lentivirus (self-inactivating), pU6-(KHDRBS1-shRNA-Seq2)(CAT#: LV-SI0045WQ)

This product is a KHDRBS1-shRNA encoding Lentivirus, which is based on HIV-1 serotype.The KHDRBS1 encoded protein appears to have many functions and may be involved in a variety of cellular processes, including alternative splicing, cell cycle regulation, RNA 3'-end formation, tumorigenesis, and regulation of human immunodeficiency virus gene expression. The expression of KHDRBS1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert KHDRBS1-shRNA-Seq2
Related Target/Protein KHDRBS1
Region CDS
TargetSeq GTACCGGATATGATGGATGAT
NCBI RefSeq NM_006559
Alternative Names p62; p68; Sam68
Titer >1*10^10 GC/mL
Related Diseases Primary ovarian insufficiency
Target Gene
Gene ID 10657
Uniprot ID Q07666

Related Products