shRNA Lentivirus (self-inactivating), pU6-(Lactb2-shRNA-Seq3)(CAT#: LV-SI1935WQ)
This product is a Lactb2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Lactb2 gene is required for normal mitochondrial function and cell viability. The expression of Lactb2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Lactb2-shRNA-Seq3 |
Related Target/Protein | Lactb2 |
Region | CDS |
TargetSeq | CCGAGAAGAACAGATTATTTC |
NCBI RefSeq | NM_145381 |
Alternative Names | CGI-83 |
Titer | >1*10^10 GC/mL |