shRNA Lentivirus (self-inactivating), pU6-(LY6G6D-shRNA-Seq2)(CAT#: LV-SI0168WQ)
This product is a LY6G6D-shRNA encoding Lentivirus, which is based on HIV-1 serotype. LY6G6D belongs to a cluster of leukocyte antigen-6 (LY6) genes and most LY6 proteins are attached to the cell surface by a glycosylphosphatidylinositol (GPI) anchor that is directly involved in signal transduction. The expression of LY6G6D-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | LY6G6D-shRNA-Seq2 |
Related Target/Protein | LY6G6D |
Region | CDS |
TargetSeq | GAGCCGAAGACCAAGAATCAT |
NCBI RefSeq | NM_021246 |
Alternative Names | G6D; NG25; LY6-D; MEGT1; C6orf23 |
Titer | >1*10^10 GC/mL |
Related Diseases | Colorectal cancer |