shRNA Lentivirus (self-inactivating), pU6-(Mettl4-shRNA-Seq3)(CAT#: LV-SI1848WQ)

This product is a Mettl4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Mettl4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Mettl4-shRNA-Seq3
Related Target/Protein Mettl4
Region 3UTR
TargetSeq CTGTCTTTACCTCAGCTCCTT
NCBI RefSeq NM_176917
Alternative Names HsT661
Titer >1*10^10 GC/mL
Target Gene
Gene ID 64863
Uniprot ID Q8N3J2

Related Products