shRNA Lentivirus (self-inactivating), pU6-(MUM1L1-shRNA-Seq2)(CAT#: LV-SI0455WQ)
This product is a MUM1L1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The MUM1L1 gene encodes a protein which contains a mutated melanoma-associated antigen 1 domain. The expression of MUM1L1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | MUM1L1-shRNA-Seq2 |
| Related Target/Protein | MUM1L1 |
| Region | 3UTR |
| TargetSeq | CCAGAATCTGAGAATTTGGAA |
| NCBI RefSeq | NM_152423 |
| Alternative Names | MUM1L1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Endometrial carcinoma |
