shRNA Lentivirus (self-inactivating), pU6-(NSMAF-shRNA-Seq3)(CAT#: LV-SI1711WQ)
This product is a NSMAF-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The NSMAF gene encodes a WD-repeat protein that binds the cytoplasmic sphingomyelinase activation domain of the 55kD tumor necrosis factor receptor and may play a role in regulating TNF-induced cellular responses such as inflammation. The expression of NSMAF-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | NSMAF-shRNA-Seq3 |
Related Target/Protein | NSMAF |
Region | 3UTR |
TargetSeq | GCAGAGAATAGCTAAGAGATA |
NCBI RefSeq | NM_003580 |
Alternative Names | FAN; GRAMD5 |
Titer | >1*10^10 GC/mL |
Related Diseases | Inflammation |