shRNA Lentivirus (self-inactivating), pU6-(Olfr410-shRNA-Seq1)(CAT#: LV-SI2309WQ)
This product is a Olfr410-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Olfr410 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr410-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Olfr410-shRNA-Seq1 |
Related Target/Protein | Olfr410 |
Region | CDS |
TargetSeq | CTTAGTCCATAAGCGTACAAT |
NCBI RefSeq | NM_146707 |
Alternative Names | MOR255-5 |
Titer | >1*10^10 GC/mL |
Related Diseases | Olfactory dysfunction |