shRNA Lentivirus (self-inactivating), pU6-(Olfr77-shRNA-Seq1)(CAT#: LV-SI2310WQ)

This product is a Olfr77-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Olfr77 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr77-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Olfr77-shRNA-Seq1
Related Target/Protein Olfr77
Region CDS
TargetSeq CTTCTCTACTAGCACTGAAAT
NCBI RefSeq NM_146339
Alternative Names 18A; MOR143-1
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 258336
Uniprot ID Q8VEY9

Related Products