shRNA Lentivirus (self-inactivating), pU6-(OR6C76-shRNA-Seq4)(CAT#: LV-SI1583WQ)

This product is a OR6C76-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR6C76 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR6C76-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR6C76-shRNA-Seq4
Related Target/Protein OR6C76
Region CDS
TargetSeq CTGCATCTTCATGTATGTGAA
NCBI RefSeq XM_372463
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 390326
Uniprot ID A6NM76

Related Products