shRNA Lentivirus (self-inactivating), pU6-(OR8J3-shRNA-Seq2)(CAT#: LV-SI2111WQ)
This product is a OR8J3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR8J3 gene encodes an odorant receptor. The expression of OR8J3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | OR8J3-shRNA-Seq2 |
Related Target/Protein | OR8J3 |
Region | CDS |
TargetSeq | CATACCAGAAACAATAGTCTT |
NCBI RefSeq | NM_001004064 |
Alternative Names | OR11-173 |
Titer | >1*10^10 GC/mL |
Related Diseases | Olfactory dysfunction |