shRNA Lentivirus (self-inactivating), pU6-(OR8J3-shRNA-Seq2)(CAT#: LV-SI2111WQ)

Datasheet

This product is a OR8J3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR8J3 gene encodes an odorant receptor. The expression of OR8J3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR8J3-shRNA-Seq2
Related Target/Protein OR8J3
Region CDS
TargetSeq CATACCAGAAACAATAGTCTT
NCBI RefSeq NM_001004064
Alternative Names OR11-173
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 81168
Uniprot ID Q8NGG0

Related Products

shRNA Lentivirus (self-inactivating), pU6-(BC027231-shRNA-Seq2) (CAT#:LV-SI1984WQ) shRNA Lentivirus (self-inactivating), pH1-(4933409G03Rik-shRNA-Seq6) (CAT#:LV-SI2648WQ) Recombinant lentivirus, pU6-(Rattus Hnf1b), Overexpression (CAT#:Lenti-GTOH0667WQ) Recombinant lentivirus, pU6-(Human cytomegalovirus hcmv-mir-UL112), Overexpression (CAT#:Lenti-GTOH0204WQ) shRNA Lentivirus (self-inactivating), pH1-(CDCA3-shRNA-Seq2) (CAT#:LV-SI0624WQ) shRNA Lentivirus (self-inactivating), p7SK-(OR8H3-shRNA-Seq1) (CAT#:LV-SI3846WQ) shRNA Lentivirus (self-inactivating), pH1-(OR2AE1-shRNA-Seq1) (CAT#:LV-SI2485WQ) shRNA Lentivirus (self-inactivating), pU6-(Erc1-shRNA-Seq1) (CAT#:LV-SI2336WQ)