shRNA Lentivirus (self-inactivating), pU6-(Poc5-shRNA-Seq5)(CAT#: LV-SI1893WQ)
This product is a Poc5-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Poc5 gene is essential for the assembly of the distal half of centrioles, required for centriole elongation. The expression of Poc5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Poc5-shRNA-Seq5 |
Related Target/Protein | Poc5 |
Region | CDS |
TargetSeq | GAAGACAATTACAGCCCGGAT |
NCBI RefSeq | NM_026173 |
Alternative Names | C5orf37 |
Titer | >1*10^10 GC/mL |