shRNA Lentivirus (self-inactivating), pU6-(RSBN1-shRNA-Seq2)(CAT#: LV-SI0074WQ)

This product is a RSBN1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The RSBN1 gene specifically demethylates dimethylated 'Lys-20' of histone H4 (H4K20me2), thereby modulating chromosome architecture. The expression of RSBN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert RSBN1-shRNA-Seq2
Related Target/Protein RSBN1
Region CDS
TargetSeq CACTCAGGTCAACAGGACATA
NCBI RefSeq NM_018364
Alternative Names KDM9; ROSBIN
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 54665
Uniprot ID Q80T69

Related Products