shRNA Lentivirus (self-inactivating), pU6-(SCAF1-shRNA-Seq3)(CAT#: LV-SI0280WQ)
This product is a SCAF1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SCAF1 may function in pre-mRNA splicing. The expression of SCAF1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | SCAF1-shRNA-Seq3 |
Related Target/Protein | SCAF1 |
Region | CDS |
TargetSeq | CACAGATAAGTATCTGAAGAA |
NCBI RefSeq | NM_021228 |
Alternative Names | SRA1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Atherosclerosis |