shRNA Lentivirus (self-inactivating), pU6-(SGMS2-shRNA-Seq2)(CAT#: LV-SI2098WQ)
This product is a SGMS2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by SGMS2 gene is an enzyme that catalyzes this reaction primarily at the cell membrane. The expression of SGMS2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | SGMS2-shRNA-Seq2 |
Related Target/Protein | SGMS2 |
Region | CDS |
TargetSeq | CCAGTGATCCTACGAACACTT |
NCBI RefSeq | NM_152621 |
Alternative Names | CDL; SMS2 |
Titer | >1*10^10 GC/mL |