shRNA Lentivirus (self-inactivating), pH1-(ENSMUSG00000063277-shRNA-Seq3)(CAT#: LV-SI3047WQ)

Datasheet

This product is a ENSMUSG00000063277-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of ENSMUSG00000063277-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert ENSMUSG00000063277-shRNA-Seq3
Related Target/Protein ENSMUSG00000063277
Region CDS
TargetSeq GATAACTATTCCTACAGCATT
NCBI RefSeq NM_025940
Alternative Names Gm10128
Titer >1*10^10 GC/mL
Target Gene
Gene ID 100042312
Uniprot ID K7N708

Related Products

shRNA Lentivirus (self-inactivating), p7SK-(CCDC11-shRNA-Seq3) (CAT#:LV-SI1486WQ) Recombinant lentivirus, pU6-(Human PLSCR1), Overexpression (CAT#:Lenti-GTOH0520WQ) shRNA Lentivirus (self-inactivating), p7SK-(Tmem231-shRNA-Seq2) (CAT#:LV-SI3523WQ) shRNA Lentivirus (self-inactivating), p7SK-(Olfr1532-ps1-shRNA-Seq2) (CAT#:LV-SI3733WQ) Lenti-TetIIP (TurboRFP-MCS)-Ubi (TetR)-Puro, Tet-on, NC (CAT#:Lenti-GTK0031WQ) shRNA Lentivirus (self-inactivating), pH1-(Cyb5d2-shRNA-Seq7) (CAT#:LV-SI2892WQ) Recombinant lentivirus, pU6-(Rattus MTOR 3'UTR), Overexpression (CAT#:Lenti-GTOH0168WQ) shRNA Lentivirus (self-inactivating), p7SK-(OR5A1-shRNA-Seq1) (CAT#:LV-SI3324WQ)