shRNA Lentivirus (self-inactivating), pU6-(Tbc1d22b-shRNA-Seq1)(CAT#: LV-SI2320WQ)
This product is a Tbc1d22b-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Tbc1d22b gene may act as a GTPase-activating protein for Rab family protein. The expression of Tbc1d22b-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Tbc1d22b-shRNA-Seq1 |
Related Target/Protein | Tbc1d22b |
Region | 3UTR |
TargetSeq | CGAGTATGTGTGTGTGTGTAT |
NCBI RefSeq | NM_198647 |
Alternative Names | C6orf197 |
Titer | >1*10^10 GC/mL |