shRNA Lentivirus (self-inactivating), pU6-(TTC21A-shRNA-Seq2)(CAT#: LV-SI0289WQ)

This product is a TTC21A-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Bi-allelic Mutations in TTC21A Induce Asthenoteratospermia in Humans and Mice. The expression of TTC21A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert TTC21A-shRNA-Seq2
Related Target/Protein TTC21A
Region CDS
TargetSeq GCAATATTGATGCCTGCCAAA
NCBI RefSeq NM_145755
Alternative Names STI2; SPGF37; IFT139A
Titer >1*10^10 GC/mL
Related Diseases Asthenoteratospermia
Target Gene
Gene ID 199223
Uniprot ID Q8NDW8

Related Products