shRNA Lentivirus (self-inactivating), pU6-(VARS2-shRNA-Seq1)(CAT#: LV-SI1533WQ)

This product is a VARS2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The VARS2 encodes a mitochondrial aminoacyl-tRNA synthetase, which catalyzes the attachment of valine to tRNA(Val) for mitochondrial translation. Mutations in this gene cause combined oxidative phosphorylation deficiency-20, and are also associated with early-onset mitochondrial encephalopathies. The expression of VARS2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert VARS2-shRNA-Seq1
Related Target/Protein VARS2
Region CDS
TargetSeq GACTCGCGATACACACATCTA
NCBI RefSeq NM_020442
Alternative Names VALRS; VARSL; VARS2L; COXPD20
Titer >1*10^10 GC/mL
Related Diseases oxidative phosphorylation deficiency-20
Target Gene
Gene ID 57176
Uniprot ID Q5ST30

Related Products