shRNA Lentivirus (self-inactivating), pU6-(OR52N2-shRNA-Seq2)(CAT#: LV-SI2125WQ)

This product is a OR52N2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR52N2 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR52N2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR52N2-shRNA-Seq2
Related Target/Protein OR52N2
Region CDS
TargetSeq CCACACCTACTGTGACCATAT
NCBI RefSeq XM_372365
Alternative Names OR11-57
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 390077
Uniprot ID Q8NGI0

Related Products