shRNA Lentivirus (self-inactivating), pU6-(Vmn1r85-shRNA-Seq4)(CAT#: LV-SI1992WQ)
This product is a Vmn1r85-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Vmn1r85 gene has pheromone binding and pheromone receptor activity. The expression of Vmn1r85-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Vmn1r85-shRNA-Seq4 |
Related Target/Protein | Vmn1r85 |
Region | CDS |
TargetSeq | CCATCTCTAGCACTTCTATTC |
NCBI RefSeq | NM_145847 |
Alternative Names | V1rj3 |
Titer | >1*10^10 GC/mL |