shRNA Lentivirus (self-inactivating), pU6-(Vmn1r85-shRNA-Seq4)(CAT#: LV-SI1992WQ)

This product is a Vmn1r85-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Vmn1r85 gene has pheromone binding and pheromone receptor activity. The expression of Vmn1r85-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Vmn1r85-shRNA-Seq4
Related Target/Protein Vmn1r85
Region CDS
TargetSeq CCATCTCTAGCACTTCTATTC
NCBI RefSeq NM_145847
Alternative Names V1rj3
Titer >1*10^10 GC/mL
Target Gene
Gene ID 252909
Uniprot ID Q8VIB8

Related Products