shRNA Lentivirus (self-inactivating), p7SK-(LGI4-shRNA-Seq3)(CAT#: LV-SI1095WQ)

This product is a LGI4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The LGI4 gene encoded protein is component of Schwann cell signaling pathway(s) that controls axon segregation and myelin formation (By similarity). The expression of LGI4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert LGI4-shRNA-Seq3
Related Target/Protein LGI4
Region CDS
TargetSeq CCCAAGACTTTCAAGTGCAGA
NCBI RefSeq NM_139284
Alternative Names LGIL3; AMCNMY
Titer >1*10^10 GC/mL
Related Diseases Neurological diseases
Target Gene
Gene ID 163175
Uniprot ID Q8N135

Related Products