shRNA Lentivirus (self-inactivating), p7SK-(LGI4-shRNA-Seq3)(CAT#: LV-SI1095WQ)
This product is a LGI4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The LGI4 gene encoded protein is component of Schwann cell signaling pathway(s) that controls axon segregation and myelin formation (By similarity). The expression of LGI4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | LGI4-shRNA-Seq3 |
Related Target/Protein | LGI4 |
Region | CDS |
TargetSeq | CCCAAGACTTTCAAGTGCAGA |
NCBI RefSeq | NM_139284 |
Alternative Names | LGIL3; AMCNMY |
Titer | >1*10^10 GC/mL |
Related Diseases | Neurological diseases |