shRNA Lentivirus (self-inactivating), pU6-(Vps13a-shRNA-Seq1)(CAT#: LV-SI2215WQ)
This product is a Vps13a-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Vps13a gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. The expression of Vps13a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Vps13a-shRNA-Seq1 |
Related Target/Protein | Vps13a |
Region | CDS |
TargetSeq | CCGTTTACAGATGTCAGTATT |
NCBI RefSeq | NM_173028 |
Alternative Names | CHAC; CHOREIN |
Titer | >1*10^10 GC/mL |
Related Diseases | Autosomal recessive disorder, chorea-acanthocytosis |