shRNA Lentivirus (self-inactivating), pU6-(Zfp414-shRNA-Seq1)(CAT#: LV-SI2231WQ)

This product is a Zfp414-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Zfp414 gene may be involved in transcriptional regulation. The expression of Zfp414-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Zfp414-shRNA-Seq1
Related Target/Protein Zfp414
Region CDS
TargetSeq GTTCGTGATCTAGCACAGCAT
NCBI RefSeq NM_026712
Alternative Names Znf414; 0610030H11Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 328801
Uniprot ID Q9DCK4

Related Products