shRNA Lentivirus (self-inactivating), pU6-(ZNF714-shRNA-Seq2)(CAT#: LV-SI0349WQ)
This product is a ZNF714-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The ZNF714 gene may be involved in transcriptional regulation. The expression of ZNF714-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | ZNF714-shRNA-Seq2 |
| Related Target/Protein | ZNF714 |
| Region | 3UTR |
| TargetSeq | CCCTCAATTCTTAACAGACAT |
| NCBI RefSeq | NM_182515 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Type 1 diabetes |
