shRNA Lentivirus (self-inactivating), pH1-(Tlcd2-shRNA-Seq1)(CAT#: LV-SI3133WQ)
This product is a Tlcd2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Tlcd2 gene encodes a protein that may regulate the composition and fluidity of the plasma membrane. The expression of Tlcd2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Tlcd2-shRNA-Seq1 |
Related Target/Protein | Tlcd2 |
Region | CDS |
TargetSeq | CATCTGTTTGCATCTACGGAA |
NCBI RefSeq | NM_027249 |
Titer | >1*10^10 GC/mL |