shRNA Lentivirus (self-inactivating), pU6-(ZNF827-shRNA-Seq2)(CAT#: LV-SI2287WQ)
This product is a ZNF827-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The ZNF827 gene encodes a protein that may be involved in transcriptional regulation. The expression of ZNF827-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | ZNF827-shRNA-Seq2 |
| Related Target/Protein | ZNF827 |
| Region | CDS |
| TargetSeq | GAAGAATATCAGCTCCAGAAA |
| NCBI RefSeq | NM_178835 |
| Titer | >1*10^10 GC/mL |
