shRNA Adeno-associated Virus Serotype 2, p7SK-(1700065I17Rik-shRNA-Seq2)(CAT#: AAV-SI3512WQ)

This product is a 1700065I17Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 1700065I17Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 1700065I17Rik-shRNA-Seq2
Related Target/Protein 1700065I17Rik
Region CDS
TargetSeq GAGATAAAGATTACCGACATG
NCBI RefSeq NM_026099
Alternative Names Tex43, Tseg7
Titer >1*10^10 GC/mL
Related Diseases Testis disease
Target Gene
Gene ID 67343
Uniprot ID C9W8M4

Related Products

Inquiry Now
Advertisement