shRNA Adeno-associated Virus Serotype 2, p7SK-(2310044H10Rik-shRNA-Seq3)(CAT#: AAV-SI3649WQ)
This product is a 2310044H10Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 2310044H10Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | 2310044H10Rik-shRNA-Seq3 |
| Related Target/Protein | 2310044H10Rik |
| Region | CDS |
| TargetSeq | CAGAAGTCTTTCTTTGCCAAA |
| NCBI RefSeq | NM_197991 |
| Alternative Names | Inm02; Mirta22; Emc10; 5430410O10Rik |
| Titer | >1*10^10 GC/mL |
| Target Gene | |
|---|---|
| Gene ID | 69683 |
| Uniprot ID | A0A0X1KG67 |
