shRNA Adeno-associated Virus Serotype 2, pH1-(SPANXN3-shRNA-Seq1)(CAT#: AAV-SI0693WQ)

This product is a SPANXN3-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of SPANXN3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SPANXN3-shRNA-Seq1
Related Target/Protein SPANXN3
Region 3UTR
TargetSeq GATGGCGATGATTACAATAAA
NCBI RefSeq NM_001009609
Alternative Names CT11.8; SPANX-N3
Titer >1*10^10 GC/mL
Related Diseases Ovarian cancer
Target Gene
Gene ID 139067
Uniprot ID Q5MJ09

Related Products

Advertisement