shRNA Adeno-associated Virus Serotype 2, p7SK-(2610109H07Rik-shRNA-Seq1)(CAT#: AAV-SI3992WQ)

This product is a 2610109H07Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 2610109H07Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 2610109H07Rik-shRNA-Seq1
Related Target/Protein 2610109H07Rik
Region CDS
TargetSeq CACACTGGACATGGCCTTATT
NCBI RefSeq NM_027426
Alternative Names neucrin; Draxin
Titer >1*10^10 GC/mL
Target Gene
Gene ID 70433
Uniprot ID Q9D043

Related Products

Inquiry Now
Advertisement