shRNA Adeno-associated Virus Serotype 2, pH1-(SPACA7-shRNA-Seq3)(CAT#: AAV-SI0597WQ)
This product is a SPACA7-shRNA encoding AAV, which is based on AAV-2 serotype. The SPACA7 gene is involved in fertilization and seems not to play a direct role in sperm-egg binding or gamete fusion. The expression of SPACA7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | SPACA7-shRNA-Seq3 |
| Related Target/Protein | SPACA7 |
| Region | CDS |
| TargetSeq | GCGAAATGCCAAGTACAGCAT |
| NCBI RefSeq | NM_145248 |
| Alternative Names | C13orf28 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |
