shRNA Adeno-associated Virus Serotype 2, p7SK-(4933405O20Rik-shRNA-Seq1)(CAT#: AAV-SI3917WQ)

This product is a 4933405O20Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by 4933405O20Rik gene is regulatory subunit which plays a role in the allosteric regulation of the enzyme catalyzing the decarboxylation of isocitrate (ICT) into alpha-ketoglutarate. The expression of 4933405O20Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 4933405O20Rik-shRNA-Seq1
Related Target/Protein 4933405O20Rik
Region CDS
TargetSeq CTTCACCAAAGTATGGAGGAA
NCBI RefSeq NM_172901
Titer >1*10^10 GC/mL
Target Gene
Gene ID 243996
Uniprot ID Q8BPC6

Related Products

Advertisement