shRNA Adeno-associated Virus Serotype 2, pU6-(MORC2-shRNA-Seq2)(CAT#: AAV-SI0376WQ)

This product is a MORC2-shRNA encoding AAV, which is based on AAV-2 serotype. The MORC2 gene encodes a member of the Microrchidia (MORC) protein superfamily. The encoded protein is known to regulate the condensation of heterochromatin in response to DNA damage and play a role in repressing transcription. The expression of MORC2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert MORC2-shRNA-Seq2
Related Target/Protein MORC2
Region CDS
TargetSeq CGGACATTAGAAGTACGCCTA
NCBI RefSeq NM_014941
Alternative Names ZCW3; CMT2Z; ZCWCC1
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 22880
Uniprot ID Q9Y6X9

Related Products