shRNA Adeno-associated Virus Serotype 2, p7SK-(A430010J10Rik-shRNA-Seq1)(CAT#: AAV-SI3909WQ)

This product is a A430010J10Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of A430010J10Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert A430010J10Rik-shRNA-Seq1
Related Target/Protein A430010J10Rik
Region CDS
TargetSeq CCTGCCTTTGCTTCACAACTT
NCBI RefSeq NM_176975
Titer >1*10^10 GC/mL
Target Gene
Gene ID 319665
Uniprot ID Q8C3Z9

Related Products

Advertisement