shRNA Adeno-associated Virus Serotype 2, pH1-(DEPDC1-shRNA-Seq1)(CAT#: AAV-SI0565WQ)

This product is a DEPDC1-shRNA encoding AAV, which is based on AAV-2 serotype. The DEPDC1 gene may be involved in transcriptional regulation as a transcriptional corepressor. The expression of DEPDC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert DEPDC1-shRNA-Seq1
Related Target/Protein DEPDC1
Region CDS
TargetSeq GAGATGGACTATTTGCTCCTT
NCBI RefSeq NM_017779
Alternative Names DEP.8; SDP35; DEPDC1A; DEPDC1-V2
Titer >1*10^10 GC/mL
Related Diseases Bladder cancer
Target Gene
Gene ID 55635
Uniprot ID Q5TB30

Related Products

Advertisement