shRNA Adeno-associated Virus Serotype 2, p7SK-(Ammecr1-shRNA-Seq1)(CAT#: AAV-SI4001WQ)

This product is a Ammecr1-shRNA encoding AAV, which is based on AAV-2 serotype. Submicroscopic deletion of the Ammecr1 may result in a contiguous gene deletion syndrome, the AMME complex. The expression of Ammecr1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Ammecr1-shRNA-Seq1
Related Target/Protein Ammecr1
Region 3UTR
TargetSeq GCCTCATGTTATAGAACAATT
NCBI RefSeq NM_019496
Alternative Names MFHIEN; AMMERC1
Titer >1*10^10 GC/mL
Related Diseases Alport syndrome, mental retardation, midface hypoplasia, and elliptocytosis
Target Gene
Gene ID 9949
Uniprot ID Q9Y4X0

Related Products

Advertisement