shRNA Adeno-associated Virus Serotype 2, pU6-(Zmynd12-shRNA-Seq2)(CAT#: AAV-SI1816WQ)

This product is a Zmynd12-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Zmynd12-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Zmynd12-shRNA-Seq2
Related Target/Protein Zmynd12
Region CDS
TargetSeq CCCTGATCATTCAAGAATCTA
NCBI RefSeq NM_001014900
Titer >1*10^10 GC/mL
Target Gene
Gene ID 84217
Uniprot ID Q9H0C1

Related Products

Advertisement