shRNA Adeno-associated Virus Serotype 2, p7SK-(BC018465-shRNA-Seq1)(CAT#: AAV-SI4012WQ)
This product is a BC018465-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of BC018465-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | BC018465-shRNA-Seq1 |
| Related Target/Protein | BC018465 |
| Region | CDS |
| TargetSeq | GATTACATCCTGCTGACCGTT |
| NCBI RefSeq | NM_144890 |
| Alternative Names | Lplunc5; Bpifb5 |
| Titer | >1*10^10 GC/mL |
