shRNA Adeno-associated Virus Serotype 2, pU6-(Cyb5d2-shRNA-Seq2)(CAT#: AAV-SI2037WQ)
This product is a Cyb5d2-shRNA encoding AAV, which is based on AAV-2 serotype. The Cyb5d2 gene encodes a heme-binding protein which promotes neuronal but not astrocyte differentiation. The expression of Cyb5d2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Cyb5d2-shRNA-Seq2 |
Related Target/Protein | Cyb5d2 |
Region | 3UTR |
TargetSeq | GGTAATTGACTGAGCTCTTAA |
NCBI RefSeq | NM_001024926 |
Alternative Names | CYB5D2 |
Titer | >1*10^10 GC/mL |