shRNA Adeno-associated Virus Serotype 2, p7SK-(BC027231-shRNA-Seq4)(CAT#: AAV-SI3686WQ)
This product is a BC027231-shRNA encoding AAV, which is based on AAV-2 serotype. The BC027231 gene may play a role in cortex development as part of the Notch signaling pathway. The expression of BC027231-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | BC027231-shRNA-Seq4 |
Related Target/Protein | BC027231 |
Region | CDS |
TargetSeq | CAGATGACATTGATGATATTT |
NCBI RefSeq | NM_145972 |
Alternative Names | Nepro |
Titer | >1*10^10 GC/mL |
Related Diseases | Neuronal differentiation and embryo development |