shRNA Adeno-associated Virus Serotype 2, p7SK-(Btla-shRNA-Seq3)(CAT#: AAV-SI3430WQ)

This product is a Btla-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Btla gene is a member of the immunoglobulin superfamily and relays inhibitory signals to suppress the immune response. The expression of Btla-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Btla-shRNA-Seq3
Related Target/Protein Btla
Region CDS
TargetSeq CCCACAGAATATGCATCCATT
NCBI RefSeq NM_177584
Alternative Names BTLA1; CD272
Titer >1*10^10 GC/mL
Related Diseases Rheumatoid arthritis.
Target Gene
Gene ID 151888
Uniprot ID Q7Z6A9

Related Products

Inquiry Now
Advertisement