shRNA Adeno-associated Virus Serotype 2, pH1-(WDR25-shRNA-Seq3)(CAT#: AAV-SI0866WQ)
This product is a WDR25-shRNA encoding AAV, which is based on AAV-2 serotype. The WD domains of WDR25 gene are involved in protein-protein interactions in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. The expression of WDR25-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | WDR25-shRNA-Seq3 |
Related Target/Protein | WDR25 |
Region | CDS |
TargetSeq | GAAGTGACTTTAGAATCACTA |
NCBI RefSeq | NM_024515 |
Alternative Names | C14orf67 |
Titer | >1*10^10 GC/mL |