shRNA Adeno-associated Virus Serotype 2, p7SK-(C17orf77-shRNA-Seq2)(CAT#: AAV-SI1205WQ)

This product is a C17orf77-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C17orf77-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C17orf77-shRNA-Seq2
Related Target/Protein C17orf77
Region CDS
TargetSeq GTCTCTTGCTCACTTCCTGTT
NCBI RefSeq NM_152460
Titer >1*10^10 GC/mL
Target Gene
Gene ID 146723
Uniprot ID Q96MU5

Related Products

Advertisement